Stem-loop sequence ptr-let-7a-3

AccessionMI0008399 (change log)
DescriptionPan troglodytes let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention ptr-let-7a-3
(24 sentences)

Stem-loop
   -  u   gu                ---------        
5'  gg gag  aguagguuguauaguu         uggggcu 
    || |||  ||||||||||||||||         |||||| c
3'  cc uuc  ucaucuaacauaucaa         gucccgu 
   u  u   ug                uaggguauc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr22: 32894782-32894854 [+]
sense
ENSPTRT00000054237 ; ptr-let-7a-3-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7a-3
ptr-let-7a-3chr22: 32894782-32894854 [+]
ptr-let-7bchr22: 32895718-32895799 [+]
Database links

Mature sequence ptr-let-7a

Accession MIMAT0007936
Sequence

3 - 

ugagguaguagguuguauaguu

 - 24

Get sequence
Evidence by similarity; MI0000062
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).