Stem-loop sequence ptr-let-7b

AccessionMI0008400 (change log)
DescriptionPan troglodytes let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention ptr-let-7b
(10 sentences)

Stem-loop
   -    u                     ----  ---a      u 
5'  gggg gagguaguagguugugugguu    uc    gggcag g
    |||| |||||||||||||||||||||    ||    |||||| a
3'  uccc uuccgucauccaacauaucaa    ag    cccguu u
   g    -                     uaga  acuc      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr22: 32895718-32895799 [+]
sense
ENSPTRT00000061442 ; ptr-let-7b-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7b
ptr-let-7a-3chr22: 32894782-32894854 [+]
ptr-let-7bchr22: 32895718-32895799 [+]
Database links

Mature sequence ptr-let-7b

Accession MIMAT0007937
Sequence

5 - 

ugagguaguagguugugugguu

 - 26

Get sequence
Evidence by similarity; MI0000063
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).