Stem-loop sequence ptr-let-7c

AccessionMI0008401 (change log)
DescriptionPan troglodytes let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7c
(9 sentences)

Stem-loop
   ca      uu   g   u             ua  g ua a 
5'   uccggg  gag uag agguuguaugguu  ga u  c c
     ||||||  ||| ||| |||||||||||||  || |  | c
3'   agguuc  uuc auc uccaacaugucaa  uu a  g c
   cg      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr21: 2986489-2986571 [+]
sense
ENSPTRT00000054429 ; ptr-let-7c-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7c
ptr-mir-99achr21: 2985749-2985829 [+]
ptr-let-7cchr21: 2986489-2986571 [+]
Database links

Mature sequence ptr-let-7c

Accession MIMAT0007938
Sequence

10 - 

ugagguaguagguuguaugguu

 - 31

Get sequence
Evidence by similarity; MI0000064
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).