Stem-loop sequence ptr-let-7d

AccessionMI0008402 (change log)
DescriptionPan troglodytes let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7d
(9 sentences)

Stem-loop
   -      a              c      uuagggcagggauu 
5'  cuagga gagguaguagguug auaguu              u
    |||||| |||||||||||||| ||||||               
3'  gauucu uuccgucguccagc uaucaa              u
   g      -              a      uggaggaacacccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 71915622-71915707 [+]
sense
ENSPTRT00000054338 ; ptr-let-7d-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7d
ptr-let-7a-1chr9: 71912745-71912823 [+]
ptr-let-7f-1chr9: 71913135-71913220 [+]
ptr-let-7dchr9: 71915622-71915707 [+]
Database links

Mature sequence ptr-let-7d

Accession MIMAT0007939
Sequence

7 - 

agagguaguagguugcauaguu

 - 28

Get sequence
Evidence by similarity; MI0000065
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).