Stem-loop sequence ptr-let-7e

AccessionMI0008403 (change log)
DescriptionPan troglodytes let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7e
(9 sentences)

Stem-loop
   -cc   cu   g                u  ----gga  a 
5'    ggg  gag uaggagguuguauagu ga       gg c
      |||  ||| |||||||||||||||| ||       ||  
3'    ccc  uuc auccuccggcauauca cu       cc a
   gga   cu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 53915593-53915670 [+]
sense
ENSPTRT00000054385 ; ptr-let-7e-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7e
ptr-mir-99bchr19: 53915419-53915487 [+]
ptr-let-7echr19: 53915593-53915670 [+]
ptr-mir-125achr19: 53916062-53916146 [+]
Database links

Mature sequence ptr-let-7e

Accession MIMAT0007940
Sequence

7 - 

ugagguaggagguuguauaguu

 - 28

Get sequence
Evidence by similarity; MI0000066
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).