Stem-loop sequence ptr-let-7f-1

AccessionMI0008404 (change log)
DescriptionPan troglodytes let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7f-1
(9 sentences)

Stem-loop
   -   a ug                      ---------       u 
5'  cag g  agguaguagauuguauaguugu         gggguag g
    ||| |  ||||||||||||||||||||||         ||||||| a
3'  guc c  uccguuaucuaacauaucaaua         ucccauu u
   a   - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 71913135-71913220 [+]
sense
ENSPTRT00000054455 ; ptr-let-7f-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-let-7f-1
ptr-let-7a-1chr9: 71912745-71912823 [+]
ptr-let-7f-1chr9: 71913135-71913220 [+]
ptr-let-7dchr9: 71915622-71915707 [+]
Database links

Mature sequence ptr-let-7f

Accession MIMAT0007941
Sequence

6 - 

ugagguaguagauuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0000068
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).