Stem-loop sequence ptr-let-7f-2

AccessionMI0008405 (change log)
DescriptionPan troglodytes let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7f-2
(9 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   -      -   ug                uagagguucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 53204052-53204133 [-]
sense
ENSPTRT00000054239 ; ptr-let-7f-2-201; exon 1
ENSPTRT00000049267 ; HUWE1-201; intron 45
Clustered miRNAs
< 10kb from ptr-let-7f-2
ptr-let-7f-2chrX: 53204052-53204133 [-]
ptr-mir-98chrX: 53203082-53203200 [-]
Database links

Mature sequence ptr-let-7f

Accession MIMAT0007941
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence by similarity; MI0000068
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).