Stem-loop sequence ptr-let-7i

AccessionMI0008407 (change log)
DescriptionPan troglodytes let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention ptr-let-7i
(9 sentences)

Stem-loop
   cu   u                 u   --------  u     ugu 
5'   ggc gagguaguaguuugugc guu        gg cgggu   g
     ||| ||||||||||||||||| |||        || |||||   a
3'   ucg uuccgucaucgaacgcg caa        uc gcccg   c
   --   -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 27094725-27094807 [-]
sense
ENSPTRT00000054529 ; ptr-let-7i-201; exon 1
Database links

Mature sequence ptr-let-7i

Accession MIMAT0007943
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Evidence by similarity; MI0000434
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).