Stem-loop sequence ptr-mir-135a-1

Accession

MI0008536

Description

Pan troglodytes miR-135a-1 stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

agg         u u          uu            uucua 
   ccucgcugu c cuauggcuuu  auuccuauguga     c
   ||||||||| | ||||||||||  ||||||||||||     u
   ggggcggca g ggugccgagg  uagggauauacu     g
-ca         c c          -u            cacuc 

Genome context

• Coordinates (PanTro2.1.4): 3: 53138799-53138887 [-]
• Overlapping transcripts:

  sense

  ENSPTRT00000054297 ; exon 1

  ENSPTRT00000054297 ; exon 1

  ENSPTRT00000054297 ; exon 1

  antisense

  ENSPTRT00000048559 ; exon 5

  ENSPTRT00000048559 ; exon 5

Database links

• ENTREZGENE: 100316098;MIR135A-1

Mature sequence ptr-miR-135a

• Accession: MIMAT0002252
• Previous IDs: ptr-miR-135
• Sequence: 17 - uauggcuuuuuauuccuauguga - 39
• Evidence: by similarity; MI0000452
• Predicted targets:
  • TARGETSCAN-VERT:ptr-miR-135

References

1. PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).