Stem-loop sequence ptr-mir-142

AccessionMI0008543 (change log)
DescriptionPan troglodytes miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   -        g   a           c         -ug ga g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 57615879-57615964 [-]
sense
ENSPTRT00000054515 ; ptr-mir-142-201; exon 1
Database links

Mature sequence ptr-miR-142

Accession MIMAT0008037
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Evidence by similarity; MI0000458
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).