Stem-loop sequence ptr-mir-181b-2

Accession MI0008556
Description Pan troglodytes miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-uga   -     cucaa         cu           u  gu 
    ugg cugca     cauucauug  gucgguggguu ga  c
    ||| |||||     |||||||||  ||||||||||| ||  u
    acc ggcgu     guaaguagc  uagucacucaa cu  g
acaa   a     caaac         --           -  aa 
Get sequence
Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
9: 123767418-123767505 [+]
sense
antisense
ENSPTRT00000039503 ; A2T6X3_PANTR; intron 2
ENSPTRT00000061758 ; A2T6X3_PANTR; intron 2
ENSPTRT00000039503 ; A2T6X3_PANTR; intron 2
ENSPTRT00000039503 ; A2T6X3_PANTR; intron 2
Clustered miRNAs
< 10kb from ptr-mir-181b-2
ptr-mir-181a-2 9: 123766154-123766263 [+]
ptr-mir-181b-2 9: 123767418-123767505 [+]
Database links

Mature sequence ptr-miR-181b

Accession MIMAT0002625
Sequence

15 - 

aacauucauugcugucggugggu

 - 37

Get sequence
Evidence by similarity; MI0000683
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).