Stem-loop sequence ptr-mir-30c-1

AccessionMI0008605 (change log)
DescriptionPan troglodytes miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention ptr-mir-30c-1
(2 sentences)

Stem-loop
   -     cu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 40188188-40188275 [+]
sense
ENSPTRT00000054278 ; ptr-mir-30c-1-201; exon 1
ENSPTRT00000001139 ; NFYC-201; intron 5
Clustered miRNAs
< 10kb from ptr-mir-30c-1
ptr-mir-30echr1: 40185260-40185350 [+]
ptr-mir-30c-1chr1: 40188188-40188275 [+]
Database links

Mature sequence ptr-miR-30c

Accession MIMAT0002614
Sequence

16 - 

uguaaacauccuacacucucagc

 - 38

Get sequence
Evidence by similarity; MI0000736
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).