Stem-loop sequence ptr-mir-323

AccessionMI0008615 (change log)
DescriptionPan troglodytes miR-323 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ----u      u g        g u     gcgc  u    uua 
5'      gguacu g agagaggu g ccgug    gu cgcu   u
        |||||| | |||||||| | |||||    || ||||    
3'      cuauga c uuucucca c ggcac    ca gcgg   u
   cuaau      - g        g u     auua  c    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86274233-86274317 [+]
sense
ENSPTRT00000054290 ; ptr-mir-323-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-323
ptr-mir-379chr14: 86270569-86270634 [+]
ptr-mir-411chr14: 86271826-86271920 [+]
ptr-mir-299chr14: 86272294-86272362 [+]
ptr-mir-380chr14: 86273518-86273577 [+]
ptr-mir-1197chr14: 86274065-86274151 [+]
ptr-mir-323chr14: 86274233-86274317 [+]
ptr-mir-758chr14: 86274527-86274613 [+]
ptr-mir-329-1chr14: 86275292-86275370 [+]
ptr-mir-329-2chr14: 86275609-86275687 [+]
ptr-mir-494chr14: 86278152-86278231 [+]
ptr-mir-543chr14: 86280507-86280583 [+]
ptr-mir-495chr14: 86282275-86282355 [+]
Database links

Mature sequence ptr-miR-323

Accession MIMAT0008097
Sequence

50 - 

cacauuacacggucgaccucu

 - 70

Get sequence
Evidence by similarity; MI0000807
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).