Stem-loop sequence ptr-mir-375

AccessionMI0008645 (change log)
DescriptionPan troglodytes miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention ptr-mir-375
(2 sentences)

Stem-loop
   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   -  a    -      cuu  u     u  gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr2B: 109920747-109920809 [-]
sense
ENSPTRT00000054226 ; ptr-mir-375-201; exon 1
Database links

Mature sequence ptr-miR-375

Accession MIMAT0008125
Sequence

40 - 

uuuguucguucggcucgcguga

 - 61

Get sequence
Evidence by similarity; MI0000783
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).