Stem-loop sequence ptr-mir-375

Accession

MI0008645 (change log)

Description

Pan troglodytes miR-375 stem-loop

Gene family

MIPF0000114; mir-375

Literature search

1 open access papers mention ptr-mir-375
(2 sentences)

Stem-loop

   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   -  a    -      cuu  u     u  gag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Pan_tro3.0; GCA_000001515.5): chr2B: 109920747-109920809 [-]
• Overlapping transcripts:

  sense

  ENSPTRT00000054226 ; ptr-mir-375-201; exon 1

Database links

• EntrezGene:MIR375
• miRBase Tracker:MI0008645

Mature sequence ptr-miR-375

• Accession: MIMAT0008125
• Sequence: 40 - uuuguucguucggcucgcguga - 61
• Evidence: by similarity; MI0000783
• Predicted targets:
  • TargetScanVert:ptr-miR-375

References

1. PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).