![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-375 |
|||||
Accession | MI0008645 (change log) | ||||
Description | Pan troglodytes miR-375 stem-loop | ||||
Gene family | MIPF0000114; mir-375 | ||||
Literature search |
1 open access papers mention ptr-mir-375 | ||||
Stem-loop |
c - a ccu c c gac 5' cc cgcg cgagcc cg acaaa cg c || |||| |||||| || ||||| || 3' gg gugc gcucgg gc uguuu gc u - a - cuu u u gag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-375 |
|
Accession | MIMAT0008125 |
Sequence |
40 - uuuguucguucggcucgcguga - 61 |
Evidence | by similarity; MI0000783 |
Predicted targets |
|
References |
|
1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|