Stem-loop sequence ptr-mir-377

AccessionMI0008650 (change log)
DescriptionPan troglodytes miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u              c   -    a    - uuu 
5'  gagcagagguugcc uug guga uucg c   a
    |||||||||||||| ||| |||| |||| |   u
3'  uuuguuuucaacgg aac cacu aagu g   u
   g              a   a    -    u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86310299-86310366 [+]
sense
ENSPTRT00000054424 ; ptr-mir-377-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-377
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
ptr-mir-412chr14: 86313697-86313786 [+]
ptr-mir-369chr14: 86313848-86313916 [+]
ptr-mir-410chr14: 86314162-86314240 [+]
ptr-mir-656chr14: 86314977-86315053 [+]
Database links

Mature sequence ptr-miR-377

Accession MIMAT0008129
Sequence

44 - 

aucacacaaaggcaacuuuugu

 - 65

Get sequence
Evidence by similarity; MI0000785
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).