Stem-loop sequence ptr-mir-453

AccessionMI0008677 (change log)
DescriptionPan troglodytes miR-453 stem-loop
Gene family MIPF0000018; mir-154
   -----cag     c       agugccaccucaugguacuc 
5'         gaaug ugcgagc                    g
           ||||| |||||||                     
3'         uuuau acgcuug                    g
   cguaguaa     u       aguggugccuguuggaggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86304425-86304503 [+]
Clustered miRNAs
< 10kb from ptr-mir-453
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
ptr-mir-412chr14: 86313697-86313786 [+]
ptr-mir-369chr14: 86313848-86313916 [+]
ptr-mir-410chr14: 86314162-86314240 [+]
Database links

Mature sequence ptr-miR-453

Accession MIMAT0008155

43 - 


 - 65

Get sequence
Evidence by similarity; MI0001727
Predicted targets


PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).