Stem-loop sequence ptr-mir-485

AccessionMI0008681 (change log)
DescriptionPan troglodytes miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
   -  ug        cu       -    a    auuc 
5'  cu  gagagagg  ggccgug auga uucg    a
    ||  ||||||||  ||||||| |||| ||||    u
3'  ga  uucucucc  ucggcac uacu gagc    c
   u  uu        uc       a    -    gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86303654-86303725 [+]
sense
ENSPTRT00000054230 ; ptr-mir-485-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-485
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
Database links

Mature sequence ptr-miR-485

Accession MIMAT0008159
Sequence

45 - 

gucauacacggcucuccucucu

 - 66

Get sequence
Evidence by similarity; MI0002469
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).