Stem-loop sequence ptr-mir-487b

AccessionMI0008684 (change log)
DescriptionPan troglodytes miR-487b stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -       ug        uuau      c u     uuuug 
5'  ugguacu  gagagugg    cccugu c guucg     c
    |||||||  ||||||||    |||||| | |||||      
3'  acuauga  uuuucacc    gggaca g uaagc     u
   a       cu        uacu      u c     uguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86294699-86294781 [+]
sense
ENSPTRT00000054699 ; ptr-mir-487b-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-487b
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
ptr-mir-1185-2chr14: 86292441-86292525 [+]
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
Database links

Mature sequence ptr-miR-487b

Accession MIMAT0008162
Sequence

50 - 

aaucguacagggucauccacuu

 - 71

Get sequence
Evidence by similarity; MI0003530
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).