Stem-loop sequence ptr-mir-494

AccessionMI0008690 (change log)
DescriptionPan troglodytes miR-494 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop 
   -     c            gu      -   c   -  uuu 
5'  auacu gaaggagagguu  ccgugu ugu uuc uc   a
    ||||| ||||||||||||  |||||| ||| ||| ||   u
3'  uauga uuuuuucuccaa  ggcaca aca aag ag   u
   c     -            ag      u   -   u  uau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86278152-86278231 [+]
sense
ENSPTRT00000054268 ; ptr-mir-494-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-494
ptr-mir-379chr14: 86270569-86270634 [+]
ptr-mir-411chr14: 86271826-86271920 [+]
ptr-mir-299chr14: 86272294-86272362 [+]
ptr-mir-380chr14: 86273518-86273577 [+]
ptr-mir-1197chr14: 86274065-86274151 [+]
ptr-mir-323chr14: 86274233-86274317 [+]
ptr-mir-758chr14: 86274527-86274613 [+]
ptr-mir-329-1chr14: 86275292-86275370 [+]
ptr-mir-329-2chr14: 86275609-86275687 [+]
ptr-mir-494chr14: 86278152-86278231 [+]
ptr-mir-543chr14: 86280507-86280583 [+]
ptr-mir-495chr14: 86282275-86282355 [+]
ptr-mir-376cchr14: 86287939-86288003 [+]
Database links

Mature sequence ptr-miR-494

Accession MIMAT0008168
Sequence

47 -  

ugaaacauacacgggaaaccuc

 - 68

Get sequence
Evidence by similarity; MI0003134
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).