Stem-loop sequence ptr-mir-495

AccessionMI0008691 (change log)
DescriptionPan troglodytes miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   -      u          u  -       au     - uuu 
5'  gguacc gaaaagaagu gc ccauguu  uuucg c   a
    |||||| |||||||||| || |||||||  ||||| |   u
3'  cuaugg uuuuucuuca cg gguacaa  aaagc g   a
   a      c          -  u       ac     a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86282275-86282355 [+]
sense
ENSPTRT00000054409 ; ptr-mir-495-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-495
ptr-mir-299chr14: 86272294-86272362 [+]
ptr-mir-380chr14: 86273518-86273577 [+]
ptr-mir-1197chr14: 86274065-86274151 [+]
ptr-mir-323chr14: 86274233-86274317 [+]
ptr-mir-758chr14: 86274527-86274613 [+]
ptr-mir-329-1chr14: 86275292-86275370 [+]
ptr-mir-329-2chr14: 86275609-86275687 [+]
ptr-mir-494chr14: 86278152-86278231 [+]
ptr-mir-543chr14: 86280507-86280583 [+]
ptr-mir-495chr14: 86282275-86282355 [+]
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
Database links

Mature sequence ptr-miR-495

Accession MIMAT0008169
Sequence

49 - 

aaacaaacauggugcacuucuu

 - 70

Get sequence
Evidence by similarity; MI0003135
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).