Stem-loop sequence ptr-mir-499

AccessionMI0008694 (change log)
DescriptionPan troglodytes miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

1 open access papers mention ptr-mir-499
(1 sentences)

Stem-loop
   -        ccugu  cuu   -    c   u  ua        a          acucc 
5'  cccugucc     gc   ggg cggg agc gu  agacuugc gugauguuua     u
    ||||||||     ||   ||| |||| ||| ||  |||||||| ||||||||||     c
3'  gggacggg     cg   ccc gccc ucg cg  ucugaacg cacuacaagu     u
   u        uccgu  cau   u    u   u  ug        a          gcacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr20: 36436961-36437081 [+]
sense
ENSPTRT00000024953 ; MYH7B-201; intron 21
Database links

Mature sequence ptr-miR-499

Accession MIMAT0008172
Sequence

69 - 

aacaucacagcaagucugugcu

 - 90

Get sequence
Evidence by similarity; MI0003183
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).