Stem-loop sequence ptr-mir-516b-2

AccessionMI0008708 (change log)
DescriptionPan troglodytes miR-516b-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    -u  u      a        uaa          g g    g 
5'  cuca  ga gugacc ucuggagg   gaagcacuuu u uuuu u
    ||||  || |||||| ||||||||   |||||||||| | |||| g
3'  gagu  cu cauugg agacuuuc   cuucgugaaa a aaga a
   a    uu  -      g        ---          g a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56072399-56072487 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-516b-2
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
ptr-mir-518dchr19: 56082272-56082357 [+]
Database links

Mature sequence ptr-miR-516b

Accession MIMAT0008183
Sequence

15 - 

aucuggagguaagaagcacuuu

 - 36

Get sequence
Evidence by similarity; MI0003172
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).