Stem-loop sequence ptr-mir-517a

AccessionMI0008709 (change log)
DescriptionPan troglodytes miR-517a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -             c       u   a    u    g  g a 
5'  cucaggcagugac cucuaga gga gcac gucu uu u u
    ||||||||||||| ||||||| ||| |||| |||| || | a
3'  gaguuugucauug gagauuu ccu cgug uaga aa a a
   a             u       c   a    c    a  g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56059195-56059280 [+]
sense
ENSPTRT00000061178 ; ptr-mir-517a-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-517a
ptr-mir-520bchr19: 56049349-56049408 [+]
ptr-mir-518bchr19: 56050864-56050945 [+]
ptr-mir-526a-1chr19: 56054378-56054461 [+]
ptr-mir-520cchr19: 56055581-56055666 [+]
ptr-mir-518cchr19: 56056864-56056963 [+]
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
Database links

Mature sequence ptr-miR-517a

Accession MIMAT0008184
Sequence

53 - 

aucgugcaucccuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003161
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).