Stem-loop sequence ptr-mir-517b-1

AccessionMI0008710 (change log)
DescriptionPan troglodytes miR-517b-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    c       u   a    u    guug  u 
5'  ugac cucuaga gga gcac gucu    uc u
    |||| ||||||| ||| |||| ||||    ||  
3'  auug gagauuu ccu cgug uaga    ag a
   c    u       c   a    c    --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56068030-56068096 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-517b-1
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
Database links

Mature sequence ptr-miR-517b

Accession MIMAT0008185
Sequence

5 - 

ccucuagauggaagcacugucu

 - 26

Get sequence
Evidence by similarity; MI0003165
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).