Stem-loop sequence ptr-mir-517b-2

AccessionMI0008711 (change log)
DescriptionPan troglodytes miR-517b-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    c       u   a    u    guugu 
5'  ugac cucuaga gga gcac gucu     c
    |||| ||||||| ||| |||| ||||     u
3'  auug gagauuu ccu cgug uaga     a
   c    u       c   a    c    aaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56088737-56088802 [+]
sense
ENSPTRT00000061068 ; ptr-mir-517b-2-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-517b-2
ptr-mir-518dchr19: 56082272-56082357 [+]
ptr-mir-516b-1chr19: 56084257-56084345 [+]
ptr-mir-518achr19: 56086733-56086818 [+]
ptr-mir-517b-2chr19: 56088737-56088802 [+]
ptr-mir-520hchr19: 56089945-56090033 [+]
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
Database links

Mature sequence ptr-miR-517b

Accession MIMAT0008185
Sequence

5 - 

ccucuagauggaagcacugucu

 - 26

Get sequence
Evidence by similarity; MI0003165
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).