Stem-loop sequence ptr-mir-518d

AccessionMI0008715 (change log)
DescriptionPan troglodytes miR-518d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -cc  u       cc              a    cu   g  u 
5'    ca gcuguga  cucuagagggaagc cuuu  guu uc g
      || |||||||  |||||||||||||| ||||  ||| || a
3'    gu uggcauu  gagguuucccuucg gaaa  caa ag a
   aga  u       ac              c    -c   -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56082272-56082357 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-518d
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
ptr-mir-518dchr19: 56082272-56082357 [+]
ptr-mir-516b-1chr19: 56084257-56084345 [+]
ptr-mir-518achr19: 56086733-56086818 [+]
ptr-mir-517b-2chr19: 56088737-56088802 [+]
ptr-mir-520hchr19: 56089945-56090033 [+]
Database links

Mature sequence ptr-miR-518d

Accession MIMAT0008189
Sequence

52 - 

caaagcgcuucccuuuggagc

 - 72

Get sequence
Evidence by similarity; MI0003171
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).