Stem-loop sequence ptr-mir-518e

AccessionMI0008716 (change log)
DescriptionPan troglodytes miR-518e stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -     -  ug    c    ag               guuggc 
5'  cucag gc  ugac cucu  agggaagcgcuuucu      u
    ||||| ||  |||| ||||  |||||||||||||||      a
3'  gaguu cg  auug gaga  ucccuucgcgaaaga      a
   a     u  ca    u    cu               aaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56077248-56077334 [+]
sense
ENSPTRT00000054264 ; ptr-mir-518e-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-518e
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
ptr-mir-518dchr19: 56082272-56082357 [+]
ptr-mir-516b-1chr19: 56084257-56084345 [+]
ptr-mir-518achr19: 56086733-56086818 [+]
Database links

Mature sequence ptr-miR-518e

Accession MIMAT0008190
Sequence

53 - 

aaagcgcuucccuucagagug

 - 73

Get sequence
Evidence by similarity; MI0003169
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).