Stem-loop sequence ptr-mir-519a

AccessionMI0008718 (change log)
DescriptionPan troglodytes miR-519a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -       u   u c     c     a         guug  u 
5'  cucaggc gug c cucua aggga gcgcuuucu    uc g
    ||||||| ||| | ||||| ||||| |||||||||    || a
3'  gaguuug cau g gagau uuccu cgugaaagg    ag a
   a       u   u u     u     a         --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56109768-56109853 [+]
sense
ENSPTRT00000061039 ; ptr-mir-519a-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-519a
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
ptr-mir-516a-2chr19: 56108558-56108646 [+]
ptr-mir-519achr19: 56109768-56109853 [+]
Database links

Mature sequence ptr-miR-519a

Accession MIMAT0008192
Sequence

53 - 

aaagugcauccuuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003182
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).