Stem-loop sequence ptr-mir-519d

AccessionMI0008721 (change log)
DescriptionPan troglodytes miR-519d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    u  u     c   c       a      uc      uuu 
5'  ccca gc gugac cuc aaaggga gcgcuu  uguuug   u
    |||| || ||||| ||| ||||||| ||||||  ||||||    
3'  gggu ug cauug gag uuucccu cgugaa  acaaac   c
   a    u  c     u   a       c      --      ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56060274-56060360 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-519d
ptr-mir-518bchr19: 56050864-56050945 [+]
ptr-mir-526a-1chr19: 56054378-56054461 [+]
ptr-mir-520cchr19: 56055581-56055666 [+]
ptr-mir-518cchr19: 56056864-56056963 [+]
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
Database links

Mature sequence ptr-miR-519d

Accession MIMAT0008195
Sequence

53 - 

caaagugccucccuuuagagug

 - 74

Get sequence
Evidence by similarity; MI0003162
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).