Stem-loop sequence ptr-mir-520c

AccessionMI0008725 (change log)
DescriptionPan troglodytes miR-520c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -       u  cg                       guug  u 
5'  cucaggc gu  uccucuagagggaagcacuuucu    uc g
    ||||||| ||  |||||||||||||||||||||||    || a
3'  gaguuug ca  gggagauuuuccuucgugaaaga    ag a
   a       c  uu                       --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56055581-56055666 [+]
sense
ENSPTRT00000061063 ; ptr-mir-520c-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-520c
ptr-mir-525chr19: 56045667-56045750 [+]
ptr-mir-523chr19: 56046532-56046610 [+]
ptr-mir-518fchr19: 56048137-56048222 [+]
ptr-mir-520bchr19: 56049349-56049408 [+]
ptr-mir-518bchr19: 56050864-56050945 [+]
ptr-mir-526a-1chr19: 56054378-56054461 [+]
ptr-mir-520cchr19: 56055581-56055666 [+]
ptr-mir-518cchr19: 56056864-56056963 [+]
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
Database links

Mature sequence ptr-miR-520c

Accession MIMAT0008199
Sequence

16 - 

ucuagagggaagcacuuucugu

 - 37

Get sequence
Evidence by similarity; MI0003158
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).