Stem-loop sequence ptr-mir-520d

AccessionMI0008726 (change log)
DescriptionPan troglodytes miR-520d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -               ua           c      guug  u 
5'  cucaagcugugacuc  caaagggaagc cuuucu    uc a
    |||||||||||||||  ||||||||||| ||||||    || a
3'  gaguuuggcauuggg  guuucucuucg gaaaga    ag a
   a               ug           u      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56067066-56067151 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-520d
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
Database links

Mature sequence ptr-miR-520d

Accession MIMAT0008200
Sequence

53 - 

aaagugcuucucuuuggugggu

 - 74

Get sequence
Evidence by similarity; MI0003164
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).