Stem-loop sequence ptr-mir-520g

AccessionMI0008729 (change log)
DescriptionPan troglodytes miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    ugcu     c         -ac      uc     guugu 
5'  ccca    gugac cucuagagg   gcacuu  uguuu     c
    ||||    ||||| |||||||||   ||||||  |||||     u
3'  gggu    cauug gagauuucc   cgugaa  acaaa     g
   a    uuac     u         cuu      --     aaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56069121-56069209 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-520g
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
Database links

Mature sequence ptr-miR-520g

Accession MIMAT0008203
Sequence

54 - 

acaaagugcuucccuuuagagugu

 - 77

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).