Stem-loop sequence ptr-mir-521-2

AccessionMI0008732 (change log)
DescriptionPan troglodytes miR-521-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    g  u     u   c         ---aa    c    gu 
5'  cuca gc gugac cuc aaagggaag     uuuu ucuu  c
    |||| || ||||| ||| |||||||||     |||| ||||   
3'  gagu ug cauug gag uuucccuuc     agaa agaa  u
   a    g  c     u   a         acgca    a    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56063505-56063590 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-521-2
ptr-mir-526a-1chr19: 56054378-56054461 [+]
ptr-mir-520cchr19: 56055581-56055666 [+]
ptr-mir-518cchr19: 56056864-56056963 [+]
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
Database links

Mature sequence ptr-miR-521

Accession MIMAT0008205
Sequence

53 - 

aacgcacuucccuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003163
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).