Stem-loop sequence ptr-mir-522

AccessionMI0008733 (change log)
DescriptionPan troglodytes miR-522 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -     -  u   u c            g  c     guug  u 
5'  cucag gc gug c cucuagagggaa cg uuucu    uc g
    ||||| || ||| | |||||||||||| || |||||    || a
3'  gaguu cg cau g gagauuucccuu gu aaaga    ag a
   a     u  -   u u            g  a     --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56098628-56098713 [+]
sense
ENSPTRT00000060994 ; ptr-mir-522-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-522
ptr-mir-517b-2chr19: 56088737-56088802 [+]
ptr-mir-520hchr19: 56089945-56090033 [+]
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
ptr-mir-516a-2chr19: 56108558-56108646 [+]
Database links

Mature sequence ptr-miR-522

Accession MIMAT0008206
Sequence

53 - 

aaaaugguucccuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003177
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).