Stem-loop sequence ptr-mir-524

AccessionMI0008735 (change log)
DescriptionPan troglodytes miR-524 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    u        c  a           a      cuug     
5'  cuca gcugugac cu caaagggaagc cuuucu    ucca 
    |||| |||||||| || ||||||||||| ||||||    ||| a
3'  gagu uggcauug ga guuucccuucg ggaaga    agga 
   a    u        u  g           c      --aa     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56057933-56058018 [+]
sense
ENSPTRT00000061232 ; ptr-mir-524-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-524
ptr-mir-518fchr19: 56048137-56048222 [+]
ptr-mir-520bchr19: 56049349-56049408 [+]
ptr-mir-518bchr19: 56050864-56050945 [+]
ptr-mir-526a-1chr19: 56054378-56054461 [+]
ptr-mir-520cchr19: 56055581-56055666 [+]
ptr-mir-518cchr19: 56056864-56056963 [+]
ptr-mir-524chr19: 56057933-56058018 [+]
ptr-mir-517achr19: 56059195-56059280 [+]
ptr-mir-519dchr19: 56060274-56060360 [+]
ptr-mir-521-2chr19: 56063505-56063590 [+]
ptr-mir-520dchr19: 56067066-56067151 [+]
Database links

Mature sequence ptr-miR-524

Accession MIMAT0008208
Sequence

52 - 

gaaggcgcuucccuuuggagu

 - 72

Get sequence
Evidence by similarity; MI0003160
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).