Stem-loop sequence ptr-mir-526a-2

AccessionMI0008738 (change log)
DescriptionPan troglodytes miR-526a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -         ag     a   cu    guug  u 
5'  ugacccucu  aggga gca  uucu    uc g
    |||||||||  ||||| |||  ||||    || a
3'  auugggaga  uuccu cgu  aaga    ag a
   c         cu     a   ac    --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56073901-56073968 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-526a-2
ptr-mir-520dchr19: 56067066-56067151 [+]
ptr-mir-517b-1chr19: 56068030-56068096 [+]
ptr-mir-520gchr19: 56069121-56069209 [+]
ptr-mir-516b-2chr19: 56072399-56072487 [+]
ptr-mir-526a-2chr19: 56073901-56073968 [+]
ptr-mir-518echr19: 56077248-56077334 [+]
ptr-mir-518gchr19: 56078436-56078532 [+]
ptr-mir-518dchr19: 56082272-56082357 [+]
Database links

Mature sequence ptr-miR-526a

Accession MIMAT0008210
Sequence

6 - 

cucuagagggaagcacuuucug

 - 27

Get sequence
Evidence by similarity; MI0003151
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).