Stem-loop sequence ptr-mir-544

AccessionMI0008744 (change log)
DescriptionPan troglodytes miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   -uuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaaa gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cucu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86296887-86296976 [+]
sense
ENSPTRT00000054772 ; ptr-mir-544-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-544
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
ptr-mir-1185-2chr14: 86292441-86292525 [+]
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
Database links

Mature sequence ptr-miR-544

Accession MIMAT0008216
Sequence

54 - 

auucugcauuuuuagcaaguuc

 - 75

Get sequence
Evidence by similarity; MI0003515
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).