Stem-loop sequence tca-mir-277

AccessionMI0008923 (change log)
DescriptionTribolium castaneum miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention tca-mir-277
(1 sentences)

Stem-loop
          -c          - c         cugcacc    u 
5' gugggcu  cgugccagau g gcguuuaca       guuc a
   |||||||  |||||||||| | |||||||||       ||||  
3' cacccga  gcauggucua c cguaaaugu       uaag a
          ca          u a         -----cu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG7: 13758830-13758910 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-277
tca-mir-317ChLG7: 13750590-13750666 [+]
tca-mir-277ChLG7: 13758830-13758910 [+]
tca-mir-34ChLG7: 13763505-13763583 [+]
Database links

Mature sequence tca-miR-277-5p

Accession MIMAT0019124
Sequence

9 - 

cgugccagaugcgcguuuacac

 - 30

Get sequence
Evidence experimental; SOLID [2]
Database links

Mature sequence tca-miR-277-3p

Accession MIMAT0008382
Previous IDstca-miR-277
Sequence

53 - 

uaaaugcacuaucugguacgaca

 - 75

Get sequence
Evidence experimental; SOLID [2]
Database links

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).