Stem-loop sequence hsv1-mir-H3

AccessionMI0008938 (change log)
DescriptionHerpes Simplex Virus 1 miR-H3 stem-loop
Gene family MIPF0000717; mir-H3
Stem-loop 
             gc   ug      -      g  u   g g 
5' ccgcgggcgc  ucc  accgcg gguucc ag ugg c u
   ||||||||||  |||  |||||| |||||| || ||| | g
3' ggugcccgcg  agg  uggcgu ucaggg uc auu g g
             gc   gu      g      -  c   g a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was named miR-I in [2].

Database links

Mature sequence hsv1-miR-H3-5p

Accession MIMAT0015279
Previous IDshsv1-miR-H3*
Sequence

12 -  

cuccugaccgcggguuccgagu

 - 33

Get sequence
Evidence experimental; Illumina [4]

Mature sequence hsv1-miR-H3-3p

Accession MIMAT0008400
Previous IDshsv1-miR-H3
Sequence

50 -  

cugggacugugcgguugggac

 - 70

Get sequence
Evidence experimental; 454 [1], qRT-PCR [1], cloned [2], Illumina [3]

References

1
PMID:18596690 "MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs" Umbach JL, Kramer MF, Jurak I, Karnowski HW, Coen DM, Cullen BR Nature. 454:780-783(2008).
2
PMID:18678906 "An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor" Tang S, Bertke AS, Patel A, Wang K, Cohen JI, Krause PR Proc Natl Acad Sci U S A. 105:10931-10936(2008).
3
PMID:19656888 "Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia" Umbach JL, Nagel MA, Cohrs RJ, Gilden DH, Cullen BR J Virol. 83:10677-10683(2009).
4
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).