![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsv1-mir-H3 |
|
Accession | MI0008938 (change log) |
Description | Herpes Simplex Virus 1 miR-H3 stem-loop |
Gene family | MIPF0000717; mir-H3 |
Stem-loop |
gc ug - g u g g 5' ccgcgggcgc ucc accgcg gguucc ag ugg c u |||||||||| ||| |||||| |||||| || ||| | g 3' ggugcccgcg agg uggcgu ucaggg uc auu g g gc gu g - c g a |
Confidence |
Annotation confidence: not enough data
|
Comments |
This sequence was named miR-I in [2]. |
Database links |
|
Mature sequence hsv1-miR-H3-5p |
|
Accession | MIMAT0015279 |
Previous IDs | hsv1-miR-H3* |
Sequence |
12 - cuccugaccgcggguuccgagu - 33 |
Evidence | experimental; Illumina [4] |
Mature sequence hsv1-miR-H3-3p |
|
Accession | MIMAT0008400 |
Previous IDs | hsv1-miR-H3 |
Sequence |
50 - cugggacugugcgguugggac - 70 |
Evidence | experimental; 454 [1], qRT-PCR [1], cloned [2], Illumina [3] |
References |
|
1 |
PMID:18596690
"MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs"
Nature. 454:780-783(2008).
|
2 |
PMID:18678906
"An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor"
Proc Natl Acad Sci U S A. 105:10931-10936(2008).
|
3 |
PMID:19656888
"Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia"
J Virol. 83:10677-10683(2009).
|
4 |
PMID:20181707
"Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2"
J Virol. 84:4659-4672(2010).
|