Stem-loop sequence dan-let-7

AccessionMI0009004 (change log)
DescriptionDrosophila ananassae let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
     u      uu   g     g           gcaacu 
5' uc ggcaaa  gag uagua guuguauagua      a
   || ||||||  ||| ||||| |||||||||||       
3' ag ucguuu  uuc aucgu uaacauaucau      a
     u      cu   g     g           gcuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_12916: 2379181-2379258 [+]
intergenic
Clustered miRNAs
< 10kb from dan-let-7
dan-mir-100scaffold_12916: 2378771-2378852 [+]
dan-let-7scaffold_12916: 2379181-2379258 [+]
dan-mir-125scaffold_12916: 2379476-2379585 [+]
Database links

Mature sequence dan-let-7

Accession MIMAT0008467
Sequence

11 - 

ugagguaguagguuguauagu

 - 31

Get sequence
Evidence by similarity; MI0000416

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).