Stem-loop sequence dgr-mir-10

Accession MI0009146
Description Drosophila grimshawi miR-10 stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ucu   -  g    u           g acacu 
ccacg   acc cu uaga ccgaauuuguu u     a
|||||   ||| || |||| ||||||||||| |      
ggugu   ugg ga aucu ggcuuaaacag a     g
     guu   a  g    u           g auuuc 
Get sequence
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14906: 11443563-11443639 [+]
intergenic

Mature sequence dgr-miR-10

Accession MIMAT0008601
Sequence

9 - 

acccuguagauccgaauuugu

 - 29

Get sequence
Evidence by similarity; MI0000130

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).