Stem-loop sequence dgr-mir-33

Accession MI0009149
Description Drosophila grimshawi miR-33 stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ag      u    a  -g           c c      -   c  a 
  gagcug cacg ag  ugcauuguagu g auuguc ugu ca a
  |||||| |||| ||  ||||||||||| | |||||| ||| || a
  cuugac gugc uc  acgugacguca c uaacgg gua gu a
ca      -    c  ga           a a      c   c  u 
Get sequence
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15110: 18214472-18214563 [-]
intergenic

Mature sequence dgr-miR-33

Accession MIMAT0008603
Sequence

15 - 

aggugcauuguagucgcauug

 - 35

Get sequence
Evidence by similarity; MI0000364

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).