Stem-loop sequence dgr-mir-281-2

Accession

MI0009177

Description

Drosophila grimshawi miR-281-2 stem-loop

Gene family

MIPF0000087; mir-46

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors.

Stem-loop

      gcg a ug        -ua     c      caa      ua 
cgaaua   a a  aagagagc   uccgu gacagu   guuaua  c
||||||   | |  ||||||||   ||||| ||||||   ||||||  c
gcuuau   u u  uucucucg   aggua cuguca   uaaugu  g
      -aa a gu        uua     -      ---      ua 

Genome context

• Coordinates (dgri_r1.3_FB2010_02): scaffold_15245: 18178390-18178482 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dgr-mir-281-2

• dgr-mir-281-1: scaffold_15245: 18178200-18178287 [+]
• dgr-mir-281-2: scaffold_15245: 18178390-18178482 [+]

Mature sequence dgr-miR-281-2-5p

• Accession: MIMAT0009184
• Previous IDs: dgr-miR-281-2*
• Sequence: 15 - aagagagcuauccgucgacagu - 36
• Evidence: by similarity; MI0000370

Mature sequence dgr-miR-281-3p

• Accession: MIMAT0008588
• Previous IDs: dgr-miR-281
• Sequence: 61 - ugucauggaauugcucucuuugu - 83
• Evidence: by similarity; MI0000370

References

1. PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).