|
miRBase |
|
Stem-loop sequence dpe-mir-31b |
||||||||||||||||||||||||||||||||||||||
| Accession | MI0009309 | |||||||||||||||||||||||||||||||||||||
| Description | Drosophila persimilis miR-31b stem-loop | |||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000064; mir-31 | |||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.
miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour.[1] From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines.[2] There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate.[3] miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer. [edit] Functionsmir-31 has been linked to Duchenne muscular dystrophy − a genetic disorder characterised by a lack of the protein dystrophin − as a potential therapeutic target. Duchenne muscular dystrophy is caused by mutations arising in the dystrophin gene, which impair the translation of dystrophin through the formation of premature termination codons.[4] miR-31 overexpression is more abundant in human Duchenne muscular dystrophy than in healthy controls, with levels remaining high only in Duchenne muscular dystrophy myoblasts. miR-31 levels in healthy controls are instead decreased with the onset of cell differentiation. miR-31 is part of the circuit controlling late muscle differentiation by repression of dystrophin synthesis, and its expression is localised specifically to regenerating myoblasts of dystrophic muscles.[5] miR-31 is believed to repress the expression of dystrophin by antisense binding of the dystrophin mRNA 3' untranslated region, and in this way it is thought that miR-31 manipulation could aid treatment for Duchenne muscular dystrophy. [edit] ApplicationsIn serous ovarian cancer, miR-31 is frequently deleted and is the most underexpressed microRNA in this cancer type. It has been shown to affect the levels of gene transcription factor p53, responsible for encoding the tumour suppressor protein p53.[6] Cancer cell lines with an inactive p53 pathway show a vulnerability to miR-31 overexpression, whilst there is resistance to overexpression in cell lines with a functional p53 pathway.[7] miR-31 overexpression is associated with a better prognosis in tumours, suggesting that therapeutic delivery of miR-31 may be beneficial in patients with p53-deficient cancers. Conversely, in gastric cancer miR-31 levels have been found to be significantly lower in tumour cells relative to healthy cells, meaning further potential for use as a diagnostic marker.[8] miR-31 has further been shown to negatively regulate FOXP3, the master regulator in T-lymphocyte development and function.[9] This is through direct binding of miR-31 at its target site in the 3'UTR of FOXP3 mRNA.[10] [edit] References
[edit] Further reading
[edit] External links
|
|||||||||||||||||||||||||||||||||||||
| Stem-loop |
-au a uc a -agag aaga uuggc agaug gg auagcug caaa a ||||| ||||| || ||||||| |||| aacug ucuac cc uaucggc guuu g guu a -u g guaaa aguaGet sequence |
|||||||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||||||
Mature sequence dpe-miR-31b |
|
| Accession | MIMAT0008752 |
| Sequence |
4 - uggcaagaugucggaauagcuga - 26 |
| Evidence | by similarity; MI0000420 |
References |
|
| 1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie
Nature. 450:203-218(2007).
|
Comments, questions? Email mirbase@manchester.ac.uk