Stem-loop sequence dse-mir-31b

Accession MI0009385
Description Drosophila sechellia miR-31b stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -     aau     a     uc  a       agagcacagcggaucgagccucuuauc 
caaa uaaug   uuggc agaug  gg auagcug                           g
|||| |||||   ||||| |||||  || |||||||                           u
guuu auuac   aacug ucuac  cc uaucggc                           c
    c     guu     a     -u  g       gaaaaguuuuuauuaguguaaaaaagc 
Get sequence
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_34: 250184-250310 [-]
intergenic

Mature sequence dse-miR-31b

Accession MIMAT0008823
Sequence

14 - 

uggcaagaugucggaauagcug

 - 35

Get sequence
Evidence by similarity; MI0000410

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).