Stem-loop sequence dsi-mir-100

AccessionMI0009437 (change log)
DescriptionDrosophila simulans miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -c    a     aa       au   aa      - u uuu 
5'   cauu acaga  cccguaa  ccg  cuugug c g   u
     |||| |||||  |||||||  |||  |||||| | |    
3'   guaa ugucu  ggguauu  ggc  gaacau g c   a
   ac    c     ga       ac   ca      u u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 18160342-18160423 [+]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-100
dsi-mir-100chr2L: 18160342-18160423 [+]
dsi-let-7chr2L: 18160945-18161022 [+]
dsi-mir-125chr2L: 18161226-18161335 [+]
Database links

Mature sequence dsi-miR-100

Accession MIMAT0008872
Sequence

12 - 

aacccguaaauccgaacuugug

 - 33

Get sequence
Evidence by similarity; MI0000378

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).