Stem-loop sequence dvi-mir-278

AccessionMI0009503 (change log)
DescriptionDrosophila virilis miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

1 open access papers mention dvi-mir-278
(2 sentences)

Stem-loop
   uu     acgg     c       u     a  a     -  gcau 
5'   auggu    ugcga cggauga gguuc ca cgacc gu    a
     |||||    ||||| ||||||| ||||| || ||||| ||    c
3'   uaccg    auguu gccugcu ucagg gu gcugg ca    u
   uu     --ca     u       u     -  g     u  auuu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 6427546-6427636 [-]
intergenic
Database links

Mature sequence dvi-miR-278-5p

Accession MIMAT0032063
Sequence

17 - 

ccggaugaugguucacaacgacc

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-278-3p

Accession MIMAT0008937
Previous IDsdvi-miR-278
Sequence

58 - 

ucggugggacuuucguccguuu

 - 79

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).