Stem-loop sequence dvi-mir-13b-1

AccessionMI0009504 (change log)
DescriptionDrosophila virilis miR-13b-1 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      -ug           c      ccu    uauu 
5' cca   ucguuaaaaug cuguga   uaug    u
   |||   ||||||||||| ||||||   ||||     
3' ggu   agcaguuuuac gacacu   auac    u
      uug           c      ---    uaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13047: 13335793-13335860 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-13b-1
dvi-mir-2cscaffold_13047: 13335417-13335514 [+]
dvi-mir-13ascaffold_13047: 13335637-13335710 [+]
dvi-mir-13b-1scaffold_13047: 13335793-13335860 [+]
Database links

Mature sequence dvi-miR-13b-5p

Accession MIMAT0032064
Sequence

6 - 

ucguuaaaaugccugugaccuuaug

 - 30

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-13b-3p

Accession MIMAT0008938
Previous IDsdvi-miR-13b
Sequence

43 - 

uaucacagccauuuugacgagu

 - 64

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).