Stem-loop sequence dvi-mir-276b

AccessionMI0009508 (change log)
DescriptionDrosophila virilis miR-276b stem-loop
Gene family MIPF0000124; mir-276
Literature search

1 open access papers mention dvi-mir-276b
(3 sentences)

Stem-loop
   ac   -     auaua   uc    a     a           -----   a 
5'   cga agucu     cca  agcg gguau gaguuccuacg     ugc a
     ||| |||||     |||  |||| ||||| |||||||||||     ||| a
3'   gcu ucggg     ggu  ucgu ccaua uucaaggaugc     acg u
   ca   g     ----a   uc    g     a           uaaua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 16093217-16093313 [+]
intergenic
Database links

Mature sequence dvi-miR-276b-5p

Accession MIMAT0032068
Sequence

21 - 

agcgagguauagaguuccu

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-276b-3p

Accession MIMAT0008942
Previous IDsdvi-miR-276b
Sequence

61 - 

uaggaacuuaauaccgugcucu

 - 82

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).