Stem-loop sequence dvi-mir-276a

AccessionMI0009509 (change log)
DescriptionDrosophila virilis miR-276a stem-loop
Gene family MIPF0000124; mir-276
Literature search

1 open access papers mention dvi-mir-276a
(3 sentences)

Stem-loop
   cc      uug   uc    a     ag          uucaau 
5'   ugguuu   cca  agcg gguau  aguuccuacg      u
     ||||||   |||  |||| |||||  ||||||||||      u
3'   accaga   ggu  ucgu ccaua  ucaaggaugc      a
   aa      --a   uc    g     cu          ucauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 16143986-16144074 [+]
intergenic
Database links

Mature sequence dvi-miR-276a-5p

Accession MIMAT0032069
Sequence

17 - 

agcgagguauagaguuccu

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-276a-3p

Accession MIMAT0008943
Previous IDsdvi-miR-276a
Sequence

56 - 

uaggaacuucauaccgugcucu

 - 77

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).